View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10591_low_27 (Length: 233)

Name: NF10591_low_27
Description: NF10591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10591_low_27
NF10591_low_27
[»] chr6 (1 HSPs)
chr6 (1-233)||(9300264-9300495)


Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 9300264 - 9300495
Alignment:
Q  1 actaatgatcatcctatgaggactagagccaagtctggcattgtgcagcctagactgaagcccactttgttacttactatgaatctaaaattgctaaaca 100  Q
    |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  9300264 actaatgatcgtcctatgaggactagagccaagtctggctttgtgcagcctagactgaagcccactttgttccttactatgaatctaaaattgctaaaca 9300363  T
Q  101 agcactctataaacccccaatggcatgctactatgcaagaagagtttgattcattagaaagaaataacacttgggattgggtttctctcccaacaaaaag 200  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||    
T  9300364 agcactctataaacccc-aatggcatgctactatgcaagaagagtttgattcattagaaagaaataacacttgagatggggtttctctcccaacaaaaag 9300462  T
Q  201 aaccgccatatataggatgcaaatgggtattca 233  Q
    |||||||||||||||||||||||||||||||||    
T  9300463 aaccgccatatataggatgcaaatgggtattca 9300495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University