View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10587_low_39 (Length: 230)

Name: NF10587_low_39
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10587_low_39
NF10587_low_39
[»] chr4 (1 HSPs)
chr4 (10-214)||(53806927-53807131)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 214
Target Start/End: Complemental strand, 53807131 - 53806927
Alignment:
Q  10 gagagaagaatgaatttaacaactgaatggaacagatggaagggaatctatacaaaacaatgtgaatggacaataatggagagactgtaccaacaaaatt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53807131 gagagaagaatgaatttaacaactgaatggaacagatggaagggaatctatacaaaacaatgtgaatggacaataatggagagactgtaccaacaaaatt 53807032  T
Q  110 ttgtccattacgtattaaaaatgaaaaacaatgttttgtccatattatccaattttgggcaccttaatcgattgattttgattgcaaagtttacggggtt 209  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||    
T  53807031 ttgtccattacgtattgaaaatgaaaaacaatgttttgtccatattatccaattttgggcaacttaatcgattgattttgatagcaaagtttacggggtt 53806932  T
Q  210 aaaac 214  Q
    |||||    
T  53806931 aaaac 53806927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University