View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10579_low_45 (Length: 301)

Name: NF10579_low_45
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10579_low_45
NF10579_low_45
[»] chr3 (2 HSPs)
chr3 (43-193)||(49756124-49756274)
chr3 (189-254)||(49757236-49757301)
[»] chr5 (1 HSPs)
chr5 (247-301)||(22940677-22940731)


Alignment Details
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 43 - 193
Target Start/End: Original strand, 49756124 - 49756274
Alignment:
Q  43 ccctcctgtgggctaacccctgggtcgcttgtgacnnnnnnnnngtcatgacaaactaaaatgatagggtcctaatactttgttaatattattatatctc 142  Q
    |||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||    
T  49756124 ccctcctgtgggctaacccctgggtcgcttgtgactttttttttgtcatgacaaactaaaatgatagggtcctaacactctgttaatattattatatctc 49756223  T
Q  143 actgtgtagaaacattggaacaaacaacactacataatatatcaactatta 193  Q
    ||||||||||||||||| ||||||||||||||||||||||||||| |||||    
T  49756224 actgtgtagaaacattgaaacaaacaacactacataatatatcaattatta 49756274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 189 - 254
Target Start/End: Original strand, 49757236 - 49757301
Alignment:
Q  189 tattaatctcaaaactcgtctagnnnnnnnttctcaaaattgacaaagcttatttcatataaacta 254  Q
    |||||||||||||||||||||||        ||||||||||| |||||||||||||||||||||||    
T  49757236 tattaatctcaaaactcgtctagaaaaaaaatctcaaaattgtcaaagcttatttcatataaacta 49757301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 247 - 301
Target Start/End: Complemental strand, 22940731 - 22940677
Alignment:
Q  247 ataaactaggctaaagtgcactttnnnnnnnttaactttcaaaaacttgcaattt 301  Q
    ||||||| ||||||||||||||||       ||||||||||||||||||||||||    
T  22940731 ataaacttggctaaagtgcacttttccccccttaactttcaaaaacttgcaattt 22940677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University