View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10579_high_32 (Length: 237)

Name: NF10579_high_32
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10579_high_32
NF10579_high_32
[»] chr7 (2 HSPs)
chr7 (1-222)||(38312240-38312461)
chr7 (73-222)||(38268539-38268688)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 38312240 - 38312461
Alignment:
Q  1 cataatgctcagcagcacactaccattactgtggctgctttagcttccattgtggccacaacatcagcctcgtcaacaccaatcaaggatgaaaagatag 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  38312240 cataatgctcagcagcacactactattactgtggctgctttagcttccattgtggccacaacagcagcctcgtcaacaccaatcaaggatgaaaagatag 38312339  T
Q  101 acaagacaaacatggatattgcttcggctgccatattagttacggtgcagtgtgttgaggctgccgaagcaatgtgagctaagcgcgacaaccttgcttc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |  |||||||||||||    
T  38312340 acaagacaaacatggatattgcttcggctgccatattagttacggtgcagtgtgttgaggctgccaaagcaatgtgagctaagtgttacaaccttgcttc 38312439  T
Q  201 tgtggttagctcagctgcgaat 222  Q
    ||||||||||||||||||||||    
T  38312440 tgtggttagctcagctgcgaat 38312461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 73 - 222
Target Start/End: Original strand, 38268539 - 38268688
Alignment:
Q  73 tcaacaccaatcaaggatgaaaagatagacaagacaaacatggatattgcttcggctgccatattagttacggtgcagtgtgttgaggctgccgaagcaa 172  Q
    ||||||| || ||||||||| ||||| | ||||||| || ||| | |||||||||||||||   ||||| | |  || ||||| ||||||||||||||||    
T  38268539 tcaacacaaaacaaggatgagaagatggccaagacagacgtggctgttgcttcggctgccactctagttgccgcacaatgtgtggaggctgccgaagcaa 38268638  T
Q  173 tgtgagctaagcgcgacaaccttgcttctgtggttagctcagctgcgaat 222  Q
    || ||||| |||||||| ||||||| || ||||| |||||||||| ||||    
T  38268639 tgggagctgagcgcgaccaccttgcatcggtggtcagctcagctgtgaat 38268688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University