View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10571_low_9 (Length: 241)

Name: NF10571_low_9
Description: NF10571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10571_low_9
NF10571_low_9
[»] chr6 (1 HSPs)
chr6 (1-225)||(9373723-9373947)


Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 9373947 - 9373723
Alignment:
Q  1 ttggaaattgagatgtttcaaagaagaagagaaattactatattggatgggataagatcataagaaga---ggctttaaaaggctcgttatgtggagaca 97  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||    
T  9373947 ttggaaattgagatgtttcaaagaagaagaaaaattactatattggatgggataagatcataagaagaagaggctttaaaaggctcgttatgtggagaca 9373848  T
Q  98 ttttgagaaaaatcacatgctactatatatatagacnnnnnnncgagcatgctgcttattattaatatagtgagaataaactagagttagatgaggtaaa 197  Q
    ||||||||||||||||||||||||||||||||||||       ||||||||||||   ||||||||||||||||||||||||||||||||||||||||||    
T  9373847 ttttgagaaaaatcacatgctactatatatatagactttttttcgagcatgctgc---ttattaatatagtgagaataaactagagttagatgaggtaaa 9373751  T
Q  198 ctagggttaatcggttggttagttagtt 225  Q
     |||||||||||||||||||||||||||    
T  9373750 ttagggttaatcggttggttagttagtt 9373723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University