View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10571_high_8 (Length: 215)

Name: NF10571_high_8
Description: NF10571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10571_high_8
NF10571_high_8
[»] chr1 (1 HSPs)
chr1 (29-181)||(29161393-29161542)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 29 - 181
Target Start/End: Complemental strand, 29161542 - 29161393
Alignment:
Q  29 atggtatccaaggcagtgacacgtgtgaggaaggtgagaagcaaacttcacacgaatcacaccatccttcctgactgagtagcccgcccacaacccagaa 128  Q
    ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||    
T  29161542 atggtatcctaggcagtgacacgtgtgaggaaggtgagaggcaaacttcacacgaatcacaccatccttc----ctgagtagcccgcccacaacccagaa 29161447  T
Q  129 aggtgcatgtcagcatttgggttagta-ttttgaactttcaaaatacaacccca 181  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  29161446 aggtgcatgtcagcatttgggttagtatttttgaactttcaaaatacaacccca 29161393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University