View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1056_low_93 (Length: 252)

Name: NF1056_low_93
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1056_low_93
NF1056_low_93
[»] chr3 (2 HSPs)
chr3 (8-126)||(44605116-44605234)
chr3 (163-252)||(44605277-44605365)


Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 8 - 126
Target Start/End: Original strand, 44605116 - 44605234
Alignment:
Q  8 ccaacaatattgtgataaatatggtcaatttaaattaagggaccaaattgatgataaatatggttgtggtctttttaaaattggagaccttctagtctct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||    
T  44605116 ccaacaatattgtgataaatatggtcaatttaaattaagggacaaaattgatgataaatatggttgcggtccttttaaaattggagaccttctagtctct 44605215  T
Q  108 attagtacacgtttttagt 126  Q
    |||||||||||||||||||    
T  44605216 attagtacacgtttttagt 44605234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 163 - 252
Target Start/End: Original strand, 44605277 - 44605365
Alignment:
Q  163 ctttagatatcaacaattcatgt--tggatcaattcataaataatatgtttgttatgtcttcaatttgacccctgctagtagaggcttggaa 252  Q
    |||||||||||||||||| ||||  ||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||    
T  44605277 ctttagatatcaacaatttatgtgttggatcaattcataaata---tgtttgttatgtcttcaatttgacccctgctagtagaggcttggaa 44605365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University