View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10567_low_31 (Length: 202)

Name: NF10567_low_31
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10567_low_31
NF10567_low_31
[»] chr4 (2 HSPs)
chr4 (89-148)||(49754939-49754998)
chr4 (15-60)||(49755076-49755121)


Alignment Details
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 89 - 148
Target Start/End: Complemental strand, 49754998 - 49754939
Alignment:
Q  89 atatgcttcttgcaatagaaacagtttggtatgtgttgaccaatagggatgaattcggta 148  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  49754998 atatgcttcttgcaatagaaacagtttggcatgtgttgaccaatagggatgaattcggta 49754939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 60
Target Start/End: Complemental strand, 49755121 - 49755076
Alignment:
Q  15 aagggaggagtaatacatgctatcgccacattctcatgtcatgttt 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  49755121 aagggaggagtaatacatgctatcgccacattctcatgtcatgttt 49755076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University