View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10567_low_29 (Length: 215)

Name: NF10567_low_29
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10567_low_29
NF10567_low_29
[»] chr8 (1 HSPs)
chr8 (1-205)||(33900065-33900269)


Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 33900269 - 33900065
Alignment:
Q  1 gtgttcccctttgcttattaatatgggattaaaacctgtgtttgatatagtttccattagttgagtgtagcttataatctttggatcataacgaatttct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33900269 gtgttcccctttgcttattaatatgggattaaaacctgtgtttgatatagtttccattagttgagtgtagcttataatctttggatcataacgaatttct 33900170  T
Q  101 gcttcttcagttgccaaggccacttgtgctatttgcaccccttgaagggattgaagaactgattgcacgttagaggagcaagaagtacaagtcatgcccc 200  Q
    |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  33900169 gcttcttcagttgccaaggccacttgtgctatttgcaccccacgaagggattgaagaactgattgcacgttggaggagcaagaagtacaagtcatgcccc 33900070  T
Q  201 ctatg 205  Q
    |||||    
T  33900069 ctatg 33900065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University