View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10561_low_18 (Length: 238)

Name: NF10561_low_18
Description: NF10561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10561_low_18
NF10561_low_18
[»] chr7 (1 HSPs)
chr7 (1-220)||(47285950-47286169)


Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 47286169 - 47285950
Alignment:
Q  1 cttcatgccagcacttaaaacatgtggatttctcaaagtaacggattcgaatcctagttggattattgagaatatgccaatggcaagagtaatgggagac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47286169 cttcatgccagcacttaaaacatgtggatttctcaaagtaacggattcgaatcctagttggattattgagaatatgccaatggcaagagtaatgggagac 47286070  T
Q  101 atgttaattctacctaacggcgatgttattataattaacggcgctggatcaggtacagctggatgggaaaacggatgtcaacctgttttaacaccggtaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  47286069 atgttaattctacctaacggcgatgttattataattaacggcgctggatcaggtacagctggatgggaaaacggacgtcaacctgttttaacaccggtaa 47285970  T
Q  201 ttttcagttcatcagaaacc 220  Q
    ||||| ||||||||||||||    
T  47285969 ttttccgttcatcagaaacc 47285950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University