View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10557_low_11 (Length: 238)

Name: NF10557_low_11
Description: NF10557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10557_low_11
NF10557_low_11
[»] chr7 (1 HSPs)
chr7 (81-238)||(1288037-1288194)


Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 81 - 238
Target Start/End: Original strand, 1288037 - 1288194
Alignment:
Q  81 atttatatatcgtttggaattcattccaactaatcaattattctgggagccagttgatgatgcaaccctattaacatcgttatggagggttatccttata 180  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1288037 atttatatatcgtttggaattcattccaactaatcaatgattctgggagccagttgatgatgcaaccctattaacatcgttatggagggttatccttata 1288136  T
Q  181 cgtggtggaggagaaaatgggcagatagagaagttgagcagagattggatagaacgac 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1288137 cgtggtggaggagaaaatgggcagatagagaagttgagcagagattggatagaacgac 1288194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University