View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10557_low_10 (Length: 238)

Name: NF10557_low_10
Description: NF10557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10557_low_10
NF10557_low_10
[»] chr2 (1 HSPs)
chr2 (1-223)||(42087133-42087361)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42087361 - 42087133
Alignment:
Q  1 cgccggttattctagaatcatttcgttgaaaatttgtttcttcgacttaggttcgatactctgacacaccggatattcagacttgagacttcaaaacaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  42087361 cgccggttattctagaatcatttcgttgaaaatttgtttcttcgacttaggttcgatactctaacacaccggatattcagacttgagacttcaaaacaaa 42087262  T
Q  101 agttattcactca------ttcagtgtagttttattgctcttcccagcagctgataagaactcatcaatacccctaacagatgaccctttaactccatct 194  Q
    |||||||||||||      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42087261 agttattcactcacgatcattcagtgtagttttattgctcttcccagcagctgataagaactcatcaatacccctaacagatgaccctttaactccatct 42087162  T
Q  195 tcttctccatctttcacagcattccttat 223  Q
    |||||||||||||||||||||||||||||    
T  42087161 tcttctccatctttcacagcattccttat 42087133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University