View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10539_low_54 (Length: 242)

Name: NF10539_low_54
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10539_low_54
NF10539_low_54
[»] chr4 (1 HSPs)
chr4 (2-223)||(2813686-2813908)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 2 - 223
Target Start/End: Complemental strand, 2813908 - 2813686
Alignment:
Q  2 tgatttttagattatataatttgaaatattataatgcatgcgagaaactttgagggtgaaaaaagaaacactctttaaactaataannnnnnngggctga 101  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||    
T  2813908 tgatttttagattatataatttgaagtattataatgcatgcgagaaactttgagggtgaaaaaagaaacactctttaaactaataatttttttgggctga 2813809  T
Q  102 gcggcaaactggcaatggtcaattagtccaagaaaatattacaccgnnnnnnnnnnnaaga--agatattgagatttgaagagcttcatctttagctcaa 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||           ||||  |||||||||||||||||||||||||||||||||||||    
T  2813808 gcggcaaactggcaatggtcaattagtccaagaaaatattacaccg-ttttttttttaagaagagatattgagatttgaagagcttcatctttagctcaa 2813710  T
Q  200 tggtattaaaaaccgcaccactct 223  Q
    |||||||||||||| |||||||||    
T  2813709 tggtattaaaaaccacaccactct 2813686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University