View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10539_low_53 (Length: 243)

Name: NF10539_low_53
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10539_low_53
NF10539_low_53
[»] chr8 (1 HSPs)
chr8 (8-133)||(5447701-5447828)


Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 8 - 133
Target Start/End: Complemental strand, 5447828 - 5447701
Alignment:
Q  8 atgcacttcacccccactcactcaccaccccc--atgcatgattaccaacacctacctggcaagtggcaacttcacctcccttcattttcatatgtttgt 105  Q
    ||||||||||||||||||||||||||||||||  |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5447828 atgcacttcacccccactcactcaccacccccccatgcatgattgccaacacctacctggcaagtggcaacttcacctcccttcattttcatatgtttgt 5447729  T
Q  106 caacaacttacaagtatcaaacaataat 133  Q
    ||||||||||||||||||||||||||||    
T  5447728 caacaacttacaagtatcaaacaataat 5447701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University