View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10539_low_39 (Length: 279)

Name: NF10539_low_39
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10539_low_39
NF10539_low_39
[»] chr3 (1 HSPs)
chr3 (19-268)||(37762554-37762803)


Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 37762803 - 37762554
Alignment:
Q  19 ccatgtgcaagttgccattgtttagcacgaagtacattacgaataacaacattgtaagcgttaagggaaggtgaatattgagctatttcgttcatccaat 118  Q
    ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  37762803 ccatgtgcaagttgccattgtttcgcacgaagtacattgcgaataacaacattgtaaacgttaagggaaggtgaatattgagctatttcgttcatccaat 37762704  T
Q  119 cgagaattgcgagggagcgttgccaatcgggttcgcgggagagaattgaaaccatgaaacgaattgaaagttgtctgccattgtaaggggacaatatgga 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  37762703 cgagaattgcgagggagcgttgccaatcgggttcgcgggagagaattgaaatcatgaaacgaattgaaagttgtctgccattgtaaggggacaatatgga 37762604  T
Q  219 gtagagttgttcgatgttttgggcttgtgcgattgaggttagtagttcat 268  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  37762603 gtagagttgttcgatgttttgggtttgtgcgattgaggttagtagttcat 37762554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University