View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10539_high_40 (Length: 235)

Name: NF10539_high_40
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10539_high_40
NF10539_high_40
[»] chr1 (1 HSPs)
chr1 (19-220)||(52471987-52472188)


Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 52471987 - 52472188
Alignment:
Q  19 atataggctgagtgtggtggtacagtgagacgtgttttgtgatctcttttaacaccgtatagtaactgtcatgtctgcttgctgctgtttagacagaaac 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52471987 atataggctgagtgtggtggtacagtgagacgtgttttgtgatctcttttaacaccgtatagtaactgtcatgtctgcttgctgctgtttagacagaaac 52472086  T
Q  119 tcacccttcttttgttagccaatttaaaaccccatccttcttagtaacaccattcagcaaggtatagaaggaggcagtctcacccgtcgattgttgccta 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  52472087 tcacccttcttttgttagccaatttaaaaccccatccttcttagtaacaccattcagcaaggtatagaaggaggcagtctcatccgtcgattgttgccta 52472186  T
Q  219 tg 220  Q
    ||    
T  52472187 tg 52472188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University