View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10539_high_14 (Length: 328)

Name: NF10539_high_14
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10539_high_14
NF10539_high_14
[»] chr1 (1 HSPs)
chr1 (19-320)||(46794800-46795101)


Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 19 - 320
Target Start/End: Complemental strand, 46795101 - 46794800
Alignment:
Q  19 gtgtagcagtggaagaatgcaacaagaagaaattaggtaccctgggcctggtgcagattcaacaaatactcaacaaatgctgcaacaattgatgtcatct 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  46795101 gtgtagcagtggaagaatgcaacaagaagaaattaggtaccctgggcctggtgcagattcaacaaatactcaacaaatgctgcaacaattgatttcatct 46795002  T
Q  119 tcaacatcacctgctgatagtactgaaactgaggcttatgcaagatggcgtcagcttcttcaacttcagacctatagtaacccttcttttcataatcatc 218  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46795001 tcaacatcacctgttgatagtactgaaactgaggcttatgcaagatggcgtcagcttcttcaacttcagacctatagtaacccttcttttcataatcatc 46794902  T
Q  219 ataacctattggatagtgaaatacctagagatcatggtggatttaatgtgattgaggaatccattatgattaaaaggaacatgatgtctgctacttcttc 318  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46794901 ataacctattggatagtgaaatacctagagatcatggtggatttaatgtgattgaggaatccattatgattaaaaggaacatgatgtctgctacttcttc 46794802  T
Q  319 tc 320  Q
    ||    
T  46794801 tc 46794800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University