View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10534_low_8 (Length: 215)

Name: NF10534_low_8
Description: NF10534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10534_low_8
NF10534_low_8
[»] chr4 (1 HSPs)
chr4 (123-200)||(19397646-19397722)


Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 123 - 200
Target Start/End: Complemental strand, 19397722 - 19397646
Alignment:
Q  123 tgatgacaaatgttgagaagagtggaaaggtacctgcctttttcttgagctatacaaaagacaaactatttacttttt 200  Q
    |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  19397722 tgatgaaaaatgttgagaagagtgaaaaggtacctgcctttttcttgagctatacaaaagac-aactatttacttttt 19397646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University