View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10521_low_45 (Length: 240)

Name: NF10521_low_45
Description: NF10521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10521_low_45
NF10521_low_45
[»] chr6 (1 HSPs)
chr6 (17-191)||(32377519-32377693)


Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 32377693 - 32377519
Alignment:
Q  17 aagtaagagataacgatagtagtaactgcaactgcaatttaaaaccatcagacacgcacatggttaattaactacgtaaccatatttttcctaggaatat 116  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32377693 aagtaagagatcacgatagtagtaactgcaactgcaatttaaaaccatcagacacgcacatggttaattaactacgtaaccatatttttcctaggaatat 32377594  T
Q  117 taattttacatcttcatgcatgcaatggatagcatagaagatttcacacacgaagaactagaagatgatcgtaat 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32377593 taattttacatcttcatgcatgcaatggatagcatagaagatttcacacacgaagaactagaagatgatcgtaat 32377519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University