View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10515_low_11 (Length: 236)

Name: NF10515_low_11
Description: NF10515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10515_low_11
NF10515_low_11
[»] chr8 (1 HSPs)
chr8 (22-219)||(4291440-4291638)


Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 219
Target Start/End: Original strand, 4291440 - 4291638
Alignment:
Q  22 tatggaagtagta-gtttacattttgtcaagaaattcagtgttgtgagagccatatgacatcatgcacagcagatgtggcaagcaaaaaacagctgatga 120  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4291440 tatggaagtagtaagtttacattttgtcaagaaattcagtgttgtgagagccatatgacatcatgcacagcagatgtggcaagcaaaaaacagctgatga 4291539  T
Q  121 aattgaaggctattgagatggcaacatggtcacaaaatttgtgcaaaggcttgcaaaaatttggaagaggtgtatgtctaattccagtgcgatttagat 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4291540 aattgaaggctattgagatggcaacatggtcacaaaatttgtgcaaaggcttgcaaaaatttggaagaggtgtatgtctaattccagtgcgatttagat 4291638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University