View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1050_high_8 (Length: 211)

Name: NF1050_high_8
Description: NF1050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1050_high_8
NF1050_high_8
[»] chr4 (1 HSPs)
chr4 (1-133)||(46449207-46449339)


Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 46449339 - 46449207
Alignment:
Q  1 ttttttctctcaggacaactgaatcccataagtttgaaaaattcaatagcagcctcacgcggcccctgatatacaatctgaccctcggacaacagaatga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46449339 ttttttctctcaggacaactgaatcccataagtttgaaaaattcaatagcagcctcacgcggcccctgatatacaatctgaccctcggacaacagaatga 46449240  T
Q  101 catcatcaaacaattcataggtctgtggtgctg 133  Q
    |||||||||||||||||||||||| ||| ||||    
T  46449239 catcatcaaacaattcataggtctctggagctg 46449207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University