View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10506_low_21 (Length: 210)

Name: NF10506_low_21
Description: NF10506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10506_low_21
NF10506_low_21
[»] chr2 (1 HSPs)
chr2 (32-194)||(22125518-22125680)


Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 32 - 194
Target Start/End: Original strand, 22125518 - 22125680
Alignment:
Q  32 gggataacatccttttacacaaatggagtgaaacaggagtagagttataaaataaaacaactattagcttcaaatgtattttacaaaatgattactataa 131  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  22125518 gggataacatccatttacacaaatggagtgaaacaggagtagagttataaaataaaacaactattagcttcaaatgtattttacaaaatgattaatataa 22125617  T
Q  132 ttgaagaaactatagctccaatataaacattttgaagcaaatgaaataaataaaagtttgaat 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22125618 ttgaagaaactatagctccaatataaacattttgaagcaaatgaaataaataaaagtttgaat 22125680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University