View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10505_low_12 (Length: 300)

Name: NF10505_low_12
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10505_low_12
NF10505_low_12
[»] chr5 (2 HSPs)
chr5 (106-217)||(7063655-7063766)
chr5 (251-282)||(7063767-7063798)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 106 - 217
Target Start/End: Original strand, 7063655 - 7063766
Alignment:
Q  106 taatattagtatttaaattactaattaaatttgagttttagtttaacgtcactagagtaatacaacactcccttttaacactttatatttaacgcttcat 205  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7063655 taatattagtatttaaattactaattaaatttgagttttagtctaacgtcactagagtaatacaacactcccttttaacactttatatttaacgcttcat 7063754  T
Q  206 cttttacaagac 217  Q
    ||||||||||||    
T  7063755 cttttacaagac 7063766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 251 - 282
Target Start/End: Original strand, 7063767 - 7063798
Alignment:
Q  251 tcaaaatggtaagaccgacccaaattttactt 282  Q
    ||||||||||||||||||||||||||||||||    
T  7063767 tcaaaatggtaagaccgacccaaattttactt 7063798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University