View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10501_low_59 (Length: 241)

Name: NF10501_low_59
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10501_low_59
NF10501_low_59
[»] chr1 (1 HSPs)
chr1 (1-222)||(5129506-5129719)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 5129719 - 5129506
Alignment:
Q  1 ccatacaataggtagggttatgaaagttcttgttttaggatgcaaatgatgtcttttctttttattgtaaaatttaatctctgttcattagtcattatct 100  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||    
T  5129719 ccatacaataggtagggttatgaaagttcttgttttaggatgaaaatgatgtcttttcttttt-ttgtaaactttaatctctgttcattagtcattatct 5129621  T
Q  101 atggttttcggagaatgacttgctaccttgttaccttcattaggaaaaacaagacagttctttatcattcagtttcctgatgtcttatatatgcttttct 200  Q
    ||||||||| |||||||||||||||||||||| ||   | |    ||  |    ||||  ||||||||||||||||||||||||||||||||||||||||    
T  5129620 atggttttcagagaatgacttgctaccttgttgcc--gagtgcttaatgc---tcagt--tttatcattcagtttcctgatgtcttatatatgcttttct 5129528  T
Q  201 tcatctatcttgtcttcttagt 222  Q
    ||||||||||||||||||||||    
T  5129527 tcatctatcttgtcttcttagt 5129506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University