View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10499_low_22 (Length: 249)

Name: NF10499_low_22
Description: NF10499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10499_low_22
NF10499_low_22
[»] chr3 (3 HSPs)
chr3 (128-235)||(48533645-48533752)
chr3 (45-209)||(48536647-48536811)
chr3 (11-61)||(48533749-48533799)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 128 - 235
Target Start/End: Complemental strand, 48533752 - 48533645
Alignment:
Q  128 acaagtttactctagagttgccggatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgaggagtcggcggatctagagtg 227  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48533752 acaagtttactctagagttgccagatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgaggagtcggcggatctagagtg 48533653  T
Q  228 agtgagtt 235  Q
    ||||||||    
T  48533652 agtgagtt 48533645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 45 - 209
Target Start/End: Complemental strand, 48536811 - 48536647
Alignment:
Q  45 gatcacaaaccaaacaatgtctccgtcgcaagctgcaggaacacgtcgtggctcaacatggactatcaatattaaaattgaacacaagtttactctagag 144  Q
    ||||| |||||||||||||||| |||| ||||||||||||||| |  |||||||| |   |||||||||||| ||| ||||||||||||||||  |||||    
T  48536811 gatcataaaccaaacaatgtctgcgtcccaagctgcaggaacagggggtggctcagcgctgactatcaatatcaaagttgaacacaagtttacggtagag 48536712  T
Q  145 ttgccggatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgagga 209  Q
    ||| |||||| || ||||| ||||||||||||||||||| |||||||||||||| |||| |||||    
T  48536711 ttggcggatctggtgaccgttgtcgctgcagattcgacgaaagcgccgagcatcgatgttgagga 48536647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 11 - 61
Target Start/End: Complemental strand, 48533799 - 48533749
Alignment:
Q  11 atgaatgaatcttgacgcaaacaaaccctgttttgatcacaaaccaaacaa 61  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48533799 atgaatgaatcttgacgcaaacaaaccctgttttgatcacaaaccaaacaa 48533749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University