View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10496_low_24 (Length: 249)

Name: NF10496_low_24
Description: NF10496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10496_low_24
NF10496_low_24
[»] chr3 (1 HSPs)
chr3 (1-240)||(34898832-34899071)


Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 34898832 - 34899071
Alignment:
Q  1 cacggggatagaaacaacaatagttaattaccatattttggtcattcgaggtgtctaaaatcctaatgtagatttgacgatacatgtctgatgggatatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34898832 cacggggatagaaacaacaatagttaattaccatattttggtcattcgaggtgtctaaaatcctaatgtagatttgacgatacatgtctgatgggatatc 34898931  T
Q  101 taccttttgctagggttttcgatcgattttgatcaacctagccttatgagccgaaaaggttaataaccggtcgtttgtgaaaaaactctcatccagtctt 200  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  34898932 taccttttgctagggttcccgatcgattttgatcaacctagccttatgagccgaaaaggttaaaaaccggtcgtttgtgaaaaaactctcatccagtctt 34899031  T
Q  201 ccttaattttttgtcggcatacttgatcaatttctctgtg 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  34899032 ccttaattttttgtcggcatacttgatcaatttctctgtg 34899071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University