View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1048_high_56 (Length: 215)

Name: NF1048_high_56
Description: NF1048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1048_high_56
NF1048_high_56
[»] chr1 (1 HSPs)
chr1 (1-137)||(31835452-31835588)


Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 31835588 - 31835452
Alignment:
Q  1 tgaaatagtacaattagattttgtattttgttagnnnnnnnattaaagtattgcttaggtatttagattttgtaaattacttcacttattggagtatggt 100  Q
    ||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  31835588 tgaaatagtacaattagattttgtattttgttagtttttttattaaagtattgcttaggtatttagattttgtaaattacttcgcttattggagtatggt 31835489  T
Q  101 caaatctctttttagtacttcttccatcctatattat 137  Q
    || || ||||||||||||||||||| | |||||||||    
T  31835488 catatttctttttagtacttcttccgttctatattat 31835452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University