View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_734 (Length: 203)

Name: NF10481A_low_734
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_734
NF10481A_low_734
[»] chr4 (1 HSPs)
chr4 (16-168)||(48399477-48399629)
[»] chr5 (1 HSPs)
chr5 (120-156)||(42111604-42111640)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 168
Target Start/End: Original strand, 48399477 - 48399629
Alignment:
Q  16 ctccaaacaatcaaatttgagtttttacctcaacttattttgcctagatggaatcgacttgtaacctcaagttttaccattttgatcttttatttgaaat 115  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48399477 ctccaagcaatcaaatttgagtttttacctcaacttattttgcctagatggaatcgacttgtaacctcaagttttaccattttgatcttttatttgaaat 48399576  T
Q  116 tatggttaaattatttaactaatgatattttaaagtcttatatgttatgtcat 168  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48399577 tatggttaaattatttaactaatgatattttaaagtcttatatgttatgtcat 48399629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 156
Target Start/End: Complemental strand, 42111640 - 42111604
Alignment:
Q  120 gttaaattatttaactaatgatattttaaagtcttat 156  Q
    ||||||||||| |||||||||||||||||||||||||    
T  42111640 gttaaattattaaactaatgatattttaaagtcttat 42111604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University