View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_678 (Length: 215)

Name: NF10481A_low_678
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_678
NF10481A_low_678
[»] chr6 (2 HSPs)
chr6 (136-188)||(29517792-29517844)
chr6 (15-62)||(29517922-29517969)


Alignment Details
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 29517844 - 29517792
Alignment:
Q  136 cagattcgctggaaatctctggaatctcttagcagcagaggaatcaacaccat 188  Q
    |||||| | ||||||||||||||||||||||||||||||||||||||||||||    
T  29517844 cagattggatggaaatctctggaatctcttagcagcagaggaatcaacaccat 29517792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 15 - 62
Target Start/End: Complemental strand, 29517969 - 29517922
Alignment:
Q  15 gacatcactacaaacttaaatgcattaaacaaagcatagcattttcca 62  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||    
T  29517969 gacataactacaaacttaaatgcattaaacaaagcatagcattttcca 29517922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University