View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_658 (Length: 220)

Name: NF10481A_low_658
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_658
NF10481A_low_658
[»] chr8 (1 HSPs)
chr8 (8-204)||(22443397-22443590)


Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 8 - 204
Target Start/End: Complemental strand, 22443590 - 22443397
Alignment:
Q  8 tgtcgaataatataggacactggcactccctggatatgcgtcccaaaagtacccaaatatattttattttacgaattattattatgataatttgcaagta 107  Q
    |||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22443590 tgtcgaaccatataggacactggcactccctggatatgcgtcccaaaagtacccaaatatattttattttacgaattattattatgataatttgcaagta 22443491  T
Q  108 cttcccaataacgcacagatacttttctatattgagatacttgtaggatactaacaatgtttttattttaagttcttccgaagacacttttgctgat 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||   ||||||||||||||||||||||    
T  22443490 cttcccaataacgcacagatacttttctatattgagatacttgtaggatactaacaatgttttttttttaag---ttccgaagacacttttgctgat 22443397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University