View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_342 (Length: 257)

Name: NF10481A_low_342
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_342
NF10481A_low_342
[»] chr1 (1 HSPs)
chr1 (137-257)||(34065440-34065559)
[»] chr4 (2 HSPs)
chr4 (202-242)||(7643067-7643107)
chr4 (162-196)||(7648003-7648037)


Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 137 - 257
Target Start/End: Original strand, 34065440 - 34065559
Alignment:
Q  137 gagtcaaacggtaaattcattacctattatgattctaaacaaaacatgatttggtgacatgtgttaaaatgtgaattgcataatttgcattggcttgtct 236  Q
    |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34065440 gagtcaaacggtaaat-catgacctattatgattctaaacaaaacatgatttggtgacatgtgttaaaatgtgaattgcataatttgcattggcttgtct 34065538  T
Q  237 atatatggaataagaaggtga 257  Q
    |||||||| ||||||||||||    
T  34065539 atatatggtataagaaggtga 34065559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 202 - 242
Target Start/End: Complemental strand, 7643107 - 7643067
Alignment:
Q  202 aaaatgtgaattgcataatttgcattggcttgtctatatat 242  Q
    ||||||||||||| ||||||||||||| |||||||||||||    
T  7643107 aaaatgtgaattgaataatttgcattgccttgtctatatat 7643067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 196
Target Start/End: Complemental strand, 7648037 - 7648003
Alignment:
Q  162 attatgattctaaacaaaacatgatttggtgacat 196  Q
    ||||||||||||||||| |||||||||||||||||    
T  7648037 attatgattctaaacaagacatgatttggtgacat 7648003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University