View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10478_high_31 (Length: 207)

Name: NF10478_high_31
Description: NF10478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10478_high_31
NF10478_high_31
[»] chr5 (1 HSPs)
chr5 (17-191)||(28414880-28415054)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 28415054 - 28414880
Alignment:
Q  17 cagagatcactcagtgatttcagccttcaagtgcttttcctctttggcatgagttcagaacttgagatagaatttccctagattgttcgggcttcaatag 116  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28415054 cagagataactcagtgatttcagccttcaagtgcttttcctctttggcatgagttcagaacttgagatagaatttccctagattgttcgggcttcaatag 28414955  T
Q  117 ctttattgtatgccatctttttgcttccattactttataagacattttaaatcagcttataaactcactctaaaa 191  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28414954 cttcattgtatgccatctttttgcttccattactttataagacattttaaatcagcttataaactcactctaaaa 28414880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University