View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10475_low_11 (Length: 217)

Name: NF10475_low_11
Description: NF10475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10475_low_11
NF10475_low_11
[»] chr8 (1 HSPs)
chr8 (24-101)||(3688727-3688804)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 24 - 101
Target Start/End: Original strand, 3688727 - 3688804
Alignment:
Q  24 ggaaaagtgaaatctaatgggtcttctaggtgttcttctgctatttctgattatcaaagctcttctcgtgaaggtgaa 101  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  3688727 ggaaaagtcaaatctaatgggtcttctaggtgttcttctgctatttctgattatcaaagctcttctcctgaaggtgaa 3688804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University