View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10473_low_26 (Length: 202)

Name: NF10473_low_26
Description: NF10473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10473_low_26
NF10473_low_26
[»] chr1 (1 HSPs)
chr1 (24-186)||(1543767-1543929)
[»] chr2 (5 HSPs)
chr2 (132-186)||(32421436-32421490)
chr2 (24-83)||(32421641-32421700)
chr2 (42-128)||(32421524-32421610)
chr2 (42-89)||(32421611-32421658)
chr2 (37-89)||(32425686-32425738)


Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 24 - 186
Target Start/End: Complemental strand, 1543929 - 1543767
Alignment:
Q  24 agggtatccgccacctgcatttggaggagcgtatccaccttgatttggaggggcatatccagcttggttgttgaaagggtatccgccaccattgttggga 123  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1543929 agggtatccaccacctgcatttggaggagcgtatccaccttgatttggaggggcatatccagcttggttgttgaaagggtatccgccaccattgttggga 1543830  T
Q  124 gggtaagcattgtttggaggtggaccagaattctgcactggaggcctactctgcatgtctctg 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1543829 gggtaagcattgtttggaggtggaccagaattctgcactggaggcctactctgcatgtctctg 1543767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 132 - 186
Target Start/End: Complemental strand, 32421490 - 32421436
Alignment:
Q  132 attgtttggaggtggaccagaattctgcactggaggcctactctgcatgtctctg 186  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  32421490 attgttgggaggtggaccagaattctgcactggaggcctactctgcatgtctctg 32421436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 32421700 - 32421641
Alignment:
Q  24 agggtatccgccacctgcatttggaggagcgtatccaccttgatttggaggggcatatcc 83  Q
    ||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||    
T  32421700 agggtatccaccacctgcatttggaggagcatatccaccttgatttggaggggcgtatcc 32421641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 128
Target Start/End: Complemental strand, 32421610 - 32421524
Alignment:
Q  42 atttggaggagcgtatccaccttgatttggaggggcatatccagcttggttgttgaaagggtatccgccaccattgttgggagggta 128  Q
    ||||||||| | |||||||  ||||||||||||||  ||||||||||| |||||   ||||||||||||| ||||||||||||||||    
T  32421610 atttggaggggagtatccagattgatttggaggggagtatccagcttgattgttaggagggtatccgccagcattgttgggagggta 32421524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 32421658 - 32421611
Alignment:
Q  42 atttggaggagcgtatccaccttgatttggaggggcatatccagcttg 89  Q
    ||||||||| |||||||| ||||||||||||||||| |||||||||||    
T  32421658 atttggaggggcgtatccgccttgatttggaggggcgtatccagcttg 32421611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 89
Target Start/End: Complemental strand, 32425738 - 32425686
Alignment:
Q  37 cctgcatttggaggagcgtatccaccttgatttggaggggcatatccagcttg 89  Q
    ||||||||||||| ||||||||| |||||||||| || ||| | |||||||||    
T  32425738 cctgcatttggagaagcgtatccgccttgatttgcagaggcgtgtccagcttg 32425686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University