View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1046_low_16 (Length: 330)

Name: NF1046_low_16
Description: NF1046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1046_low_16
NF1046_low_16
[»] chr7 (1 HSPs)
chr7 (162-255)||(6786568-6786661)


Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 162 - 255
Target Start/End: Original strand, 6786568 - 6786661
Alignment:
Q  162 taccctgacatgtagcatcaatttcaattgtgaccttagatttttgagaaagtgttctgtttgccctttcacactcgtttctcatcctcataag 255  Q
    |||||||| |||||  ||||||||||||||  ||||||||||  | |||||||||||| |||||||||||||||||||||||||||||||||||    
T  6786568 taccctgaaatgtataatcaatttcaattgcaaccttagattcgtaagaaagtgttctttttgccctttcacactcgtttctcatcctcataag 6786661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University