View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10468_low_54 (Length: 239)

Name: NF10468_low_54
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10468_low_54
NF10468_low_54
[»] chr4 (1 HSPs)
chr4 (1-224)||(51406357-51406580)


Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 51406357 - 51406580
Alignment:
Q  1 gaccaccacggacttcgacggacgggcatactaatcatctggactgccctgccttgcaaacatgacttggacactcactgaagtaagaattgcggtacac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||    
T  51406357 gaccaccacggacttcgacggacgggcatactaatcatctggactgccctgccttgcaaacatgacttggacactcactgaagtaag-atcgcggtacac 51406455  T
Q  101 ctgctcttttgttaccttctccggccatatcctgttg-aaaattatgatgttgttgatgcacaccaacatctcatatttgtaagggattaaattgcggta 199  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51406456 ctgctcttttgttaccttctccggccatatcctgttgaaaaattatgatgttgttgatgcacaccaacatctcatatttgtaagggattaaattgcggta 51406555  T
Q  200 tttaactgttccatgcgttctgctt 224  Q
    |||||||||||||||||||||||||    
T  51406556 tttaactgttccatgcgttctgctt 51406580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University