View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10468_low_29 (Length: 301)

Name: NF10468_low_29
Description: NF10468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10468_low_29
NF10468_low_29
[»] chr4 (1 HSPs)
chr4 (27-60)||(37571531-37571564)


Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 27 - 60
Target Start/End: Complemental strand, 37571564 - 37571531
Alignment:
Q  27 tggtgggaatcagtttccaaagcccgttcccgaa 60  Q
    ||||||||||||||||||||||||||||||||||    
T  37571564 tggtgggaatcagtttccaaagcccgttcccgaa 37571531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University