View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10467_high_7 (Length: 227)

Name: NF10467_high_7
Description: NF10467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10467_high_7
NF10467_high_7
[»] chr5 (1 HSPs)
chr5 (1-170)||(14308559-14308728)
[»] chr3 (1 HSPs)
chr3 (26-165)||(2467448-2467587)
[»] chr6 (3 HSPs)
chr6 (31-188)||(14438152-14438310)
chr6 (1-61)||(7872269-7872329)
chr6 (1-61)||(7815433-7815493)
[»] scaffold1089 (1 HSPs)
scaffold1089 (33-197)||(510-675)
[»] scaffold1377 (1 HSPs)
scaffold1377 (31-89)||(1343-1401)
[»] chr1 (1 HSPs)
chr1 (28-89)||(37996590-37996651)


Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 14308559 - 14308728
Alignment:
Q  1 ctattttaaactttcaatgctgcggaaatgatcttcgatttgcagcatatattttgcagaacacaagacgtttacaagacatgacaatcaacattactac 100  Q
    |||||||||||||||||||||  ||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||    
T  14308559 ctattttaaactttcaatgctatggaaatgatcttcgatttgcaacatatattttgcagaacgcaagacgtttgcaagacatgacaatcaacattactac 14308658  T
Q  101 tcacccctcaaattggatgcttttgggaaagagacaaattatagaaggattatcctcctgtccaaaaatt 170  Q
    | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  14308659 ttacccttcaaattggatgcttttgggaaagagacaaattatagaaggattatcctcctatccaaaaatt 14308728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 26 - 165
Target Start/End: Complemental strand, 2467587 - 2467448
Alignment:
Q  26 aaatgatcttcgatttgcagcatatattttgcagaacacaagacgtttacaagacatgacaatcaacattactactcacccctcaaattggatgcttttg 125  Q
    ||||||||||||||||||| ||||||| ||||||||    |||  ||||||| ||||||||||| || |||| |||  | |||||||| | | |||||||    
T  2467587 aaatgatcttcgatttgcaacatatatattgcagaatgggagaattttacaaaacatgacaatcgacgttacaactagctcctcaaatggaaagcttttg 2467488  T
Q  126 ggaaagagacaaattatagaaggattatcctcctgtccaa 165  Q
    | |||||| ||||| || |||| ||||||||| |||||||    
T  2467487 gaaaagagtcaaataattgaagaattatcctcttgtccaa 2467448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 188
Target Start/End: Complemental strand, 14438310 - 14438152
Alignment:
Q  31 atcttcgatttgcagcatatattttgcagaacacaagacgtttacaagacatgacaatcaacattactactcacccctcaaattggatgcttttgggaaa 130  Q
    ||||| |||||||| ||||||||||||||||  | || | ||||||||| ||||||||| || | |||||| |  ||||||     |||||||||  ||     
T  14438310 atcttagatttgcatcatatattttgcagaatgcgaggcttttacaagatatgacaatcgacttaactactaagtcctcaataaacatgcttttgaaaag 14438211  T
Q  131 gagacaaattatagaaggattatcctcctgtccaaaaatttctcaag-atgtaaacttt 188  Q
    ||| ||||||||||||| ||||||||| |||||||  ||||||| || |||||||||||    
T  14438210 gagtcaaattatagaagaattatcctcttgtccaaggatttctccagcatgtaaacttt 14438152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 7872269 - 7872329
Alignment:
Q  1 ctattttaaactttcaatgctgcggaaatgatcttcgatttgcagcatatattttgcagaa 61  Q
    ||||||||||||| ||  |||  | ||||||||||||||||||| ||||||||||||||||    
T  7872269 ctattttaaacttccatggctcagcaaatgatcttcgatttgcaacatatattttgcagaa 7872329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 7815433 - 7815493
Alignment:
Q  1 ctattttaaactttcaatgctgcggaaatgatcttcgatttgcagcatatattttgcagaa 61  Q
    ||||||||||||| ||| |||  | |||||||||||||||| ||  |||||||||||||||    
T  7815433 ctattttaaacttacaaggctcggaaaatgatcttcgatttacaaaatatattttgcagaa 7815493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1089 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold1089
Description:

Target: scaffold1089; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 197
Target Start/End: Complemental strand, 675 - 510
Alignment:
Q  33 cttcgatttgcagcatatattttgcagaacacaagacgtttacaagacatgacaatcaacattactactcacccctcaaattggatgcttttgggaaaga 132  Q
    |||| ||||||| |||||||| |||||||  | ||   ||||||||| ||||||||| || ||||||||| | ||||||||   |||||||| | || ||    
T  675 cttctatttgcaacatatattctgcagaatgctaggtttttacaagatatgacaatcgacgttactactcgctcctcaaatgaaatgcttttagaaagga 576  T
Q  133 gacaaattatagaaggattatcctcctgtccaaaaatttctcaag-atgtaaacttttatttgaat 197  Q
    |  |||||||||||| ||| ||||| |||||||  ||||||| || ||||||||||  ||||||||    
T  575 gtgaaattatagaagaattgtcctcttgtccaaggatttctccagcatgtaaacttacatttgaat 510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1377 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1377
Description:

Target: scaffold1377; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 89
Target Start/End: Complemental strand, 1401 - 1343
Alignment:
Q  31 atcttcgatttgcagcatatattttgcagaacacaagacgtttacaagacatgacaatc 89  Q
    |||||||||||||| ||||||||||||||||  | || | ||||||||| |||||||||    
T  1401 atcttcgatttgcaacatatattttgcagaatgcgaggcttttacaagatatgacaatc 1343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 89
Target Start/End: Complemental strand, 37996651 - 37996590
Alignment:
Q  28 atgatcttcgatttgcagcatatattttgcagaacacaagacgtttacaagacatgacaatc 89  Q
    |||||||||||||||||  |||||||||||| ||  |||| | |||||||||||||| ||||    
T  37996651 atgatcttcgatttgcaagatatattttgcataatgcaagtcttttacaagacatgagaatc 37996590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University