View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10463_low_6 (Length: 250)

Name: NF10463_low_6
Description: NF10463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10463_low_6
NF10463_low_6
[»] chr3 (1 HSPs)
chr3 (12-247)||(37227357-37227592)


Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 37227357 - 37227592
Alignment:
Q  12 cgcctcagtcgccggtgttggcgagtgctagcggggattcagatgctatgagtattgaaggggaacaaggaagaaaaacccatgattatggaagactctc 111  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37227357 cgcctcagtcgccggtggtggcgagtgctagcggggattcagatgctatgagtattgaaggggaacaaggaagaaaaacccatgattatggaagactctc 37227456  T
Q  112 tcctaagttggttgcaattttggcacagggaagtaaggatttggatggtgtttcgccgttaggttcaaaagctacgcaatcaccaaatggaaatgatatt 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  37227457 tcctaagttggttgcaattttggcacagggaagtaaggatttggatggtgtttcgctgttaggttcaaaagctacgcaatcaccaaatggaaatgatatt 37227556  T
Q  212 gaggttttacctgatttggcatgttcatctcactcg 247  Q
    ||||||||||||||||||||||||||| || |||||    
T  37227557 gaggttttacctgatttggcatgttcagctaactcg 37227592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University