View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10458_high_15 (Length: 229)

Name: NF10458_high_15
Description: NF10458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10458_high_15
NF10458_high_15
[»] chr8 (1 HSPs)
chr8 (7-229)||(37708129-37708351)


Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 37708129 - 37708351
Alignment:
Q  7 cacctttattctttttcgtcacatggaaatagatggtcattttcataactacaaatgttgcattgactataaaacaataaatttaaatgagaaacaattg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37708129 cacctttattctttttcgtcacatggaaatagatggtcattttcataactacaaatgttgcattgactataaaacaataaatttaaatgagaaacaattg 37708228  T
Q  107 atcaaatccattgatttttaggatgcacaaatgatcagaccattgnnnnnnnataattttagattcaatggcttagatttatgaaagacagcctagctac 206  Q
    ||||||||||||||||||||||||||||||||||||||||| |||       ||||||||||||||||||||||||||||||||||||||||||||||||    
T  37708229 atcaaatccattgatttttaggatgcacaaatgatcagaccgttgattttttataattttagattcaatggcttagatttatgaaagacagcctagctac 37708328  T
Q  207 tagtgtatctccaaaaaatgaaa 229  Q
    |||||||||||||||||||||||    
T  37708329 tagtgtatctccaaaaaatgaaa 37708351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University