View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10456_low_3 (Length: 615)

Name: NF10456_low_3
Description: NF10456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10456_low_3
NF10456_low_3
[»] chr7 (2 HSPs)
chr7 (406-477)||(42031532-42031603)
chr7 (543-601)||(42031670-42031728)
[»] chr2 (1 HSPs)
chr2 (223-324)||(27910902-27911003)


Alignment Details
Target: chr7 (Bit Score: 68; Significance: 5e-30; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 406 - 477
Target Start/End: Original strand, 42031532 - 42031603
Alignment:
Q  406 cttgtgttacagaacatttctctagaatggaaatatgagaatggatattttcatttttatattagtacatca 477  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  42031532 cttgtgttacagaacatttctctagaatggaaatatgagaatggatgttttcatttttatattagtacatca 42031603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 543 - 601
Target Start/End: Original strand, 42031670 - 42031728
Alignment:
Q  543 cggatttacttcgacataaggtggtttctttgaaggtgtttttacttgcttgacgtctt 601  Q
    ||||||||||| ||||||||  ||||||||||||||||| |||||||||||||||||||    
T  42031670 cggatttactttgacataagacggtttctttgaaggtgtctttacttgcttgacgtctt 42031728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 223 - 324
Target Start/End: Original strand, 27910902 - 27911003
Alignment:
Q  223 atgatgtttggatctcttaatgggaaatcgattctgaagtctagaattgattttagcataagcaactccttgtagcttttgcatctaggtgaattgattc 322  Q
    ||||||||||| ||||| || || |||| |||| ||||| |||||||||||||||  | |||| |||||||| ||||| ||| |||  ||||||||||||    
T  27910902 atgatgtttgggtctctgaagggaaaattgattatgaagcctagaattgattttactagaagctactccttggagcttctgcgtcttcgtgaattgattc 27911001  T
Q  323 ta 324  Q
    ||    
T  27911002 ta 27911003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University