View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10436_low_22 (Length: 242)

Name: NF10436_low_22
Description: NF10436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10436_low_22
NF10436_low_22
[»] chr6 (1 HSPs)
chr6 (1-232)||(32373440-32373671)


Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 32373671 - 32373440
Alignment:
Q  1 aggcattgatatctttattctctgatgccactaatgtaacacgagcgaattacgcgtatctcattgattgcgcattcggttgtttcttagcgaaaaacag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32373671 aggcattgatatctttattctctgatgccactaatgtaacacgaacgaattacgcgtatctcattgattgcgcattcggttgtttcttagcgaaaaacag 32373572  T
Q  101 tccaatagagaagaaaaagaagatattagatcttttagccgattcgacaaacttgttagttcaatggcagagaacacaatatacagatccaggtagtaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  32373571 tccaatagagaagaaaaagaagatattagatcttttagccgattcgacaaacttgttggttcaatggcagagaacacaatatacagatccaggtagtaat 32373472  T
Q  201 gtcagtgtagtaagcaacacaagtagttcatc 232  Q
    ||||||||||||||||||||||||||||||||    
T  32373471 gtcagtgtagtaagcaacacaagtagttcatc 32373440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University