View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10430_high_8 (Length: 224)

Name: NF10430_high_8
Description: NF10430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10430_high_8
NF10430_high_8
[»] chr1 (1 HSPs)
chr1 (1-205)||(37434719-37434923)


Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 37434719 - 37434923
Alignment:
Q  1 tccaacggtgctttgtgattgaagcgaggtgaggacattgtcgcagtagattccttgcggtttgttaactacgagaagatattcatcttcgtaaatgatg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  37434719 tccaacggtgctttgtgattgaagcgaggtgaggacattgtcgcagtagattccttgcggtttgttaactgcgagaagatattcatcttcgtaaatgatg 37434818  T
Q  101 tgggtttgtgccagagtgaagagttcggagtttgaagtagcgattgtggctctgttgagttcgatttgctttgagattgcgggaagttgaggtgagagtg 200  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37434819 tgggtttgtgccagagagaagagttcggagtttgaagtagcgattgtggctctgttgagttcgatttgctttgagattgcgggaagttgaggtgagagtg 37434918  T
Q  201 gtatt 205  Q
    |||||    
T  37434919 gtatt 37434923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University