View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10389_low_15 (Length: 301)

Name: NF10389_low_15
Description: NF10389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10389_low_15
NF10389_low_15
[»] chr7 (1 HSPs)
chr7 (133-288)||(35720356-35720515)


Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 133 - 288
Target Start/End: Original strand, 35720356 - 35720515
Alignment:
Q  133 gggagaagagcatttttcgccactcaa-ttgagaggaaacccagatgagcttagtcatttggcaatgcattnnnnnnnnnnn---ctcctacagtaccca 228  Q
    ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||              |||||||||||||||    
T  35720356 gggagaagagcttttttcgccactcaaattgagaggaaacccagatgagcttagtcatttggcaatgcattaaaaaaaaaaaatactcctacagtaccca 35720455  T
Q  229 taatttactgaatgcaacacagtaatgctgttgctaactctccatctactccctttgctt 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35720456 taatttactgaatgcaacacagtaatgctgttgctaactctccatctactccctttgctt 35720515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University