View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10386_low_15 (Length: 248)

Name: NF10386_low_15
Description: NF10386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10386_low_15
NF10386_low_15
[»] chr7 (1 HSPs)
chr7 (23-151)||(48289852-48289983)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 23 - 151
Target Start/End: Original strand, 48289852 - 48289983
Alignment:
Q  23 aagatcctccaacctcttgcagcgctggtaattcnnnnnnn---gtcttccctccaaccccattttatgctttaaacacccctcatgcttggatctatga 119  Q
    |||||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48289852 aagatcctccaacctcttgcagcgctggtaattttattttttttgtcttccctccaaccccattttatgctttaaacacccctcatgcttggatctatga 48289951  T
Q  120 atttttcacttttatctatatgggtattcatc 151  Q
    ||||||||||||||||| ||||||||||||||    
T  48289952 atttttcacttttatctttatgggtattcatc 48289983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University