View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10375_low_1 (Length: 206)

Name: NF10375_low_1
Description: NF10375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10375_low_1
NF10375_low_1
[»] chr2 (2 HSPs)
chr2 (86-117)||(32968591-32968622)
chr2 (28-70)||(32968515-32968557)


Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 86 - 117
Target Start/End: Original strand, 32968591 - 32968622
Alignment:
Q  86 tgaagttttggtctcctattctaaaaatcgga 117  Q
    ||||||||||||||||||||||||||||||||    
T  32968591 tgaagttttggtctcctattctaaaaatcgga 32968622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 70
Target Start/End: Original strand, 32968515 - 32968557
Alignment:
Q  28 agcagagatgcggaatgcttaaatgcattttttacccttatat 70  Q
    |||| |||||| |||||||||||||||||||||| ||||||||    
T  32968515 agcacagatgcagaatgcttaaatgcattttttatccttatat 32968557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University