View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10373_low_20 (Length: 237)

Name: NF10373_low_20
Description: NF10373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10373_low_20
NF10373_low_20
[»] chr7 (1 HSPs)
chr7 (23-224)||(35856187-35856388)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 23 - 224
Target Start/End: Original strand, 35856187 - 35856388
Alignment:
Q  23 ggcagttgcttaaccacataaagtctatccgtgacaaggaaatagatgtaggaataattaatccagcagatatattcaagttcggaggcacaaaatatta 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35856187 ggcagttgcttaaccacataaagtctatccgtgacaaggaaatagatgtaggaataattaatccagcagatatattcaagttcggaggcacaaaatatta 35856286  T
Q  123 cagatatattggttctcttacaagtccaccatgcactgaagatgttatttggacagttttgaagaaggtatatactttaattttcatgtgattctcttaa 222  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35856287 cagatatattggttctcttacaagtccaccatgtactgaagatgttatttggacagttttgaagaaggtatatactttaattttcatgtgattctcttaa 35856386  T
Q  223 ct 224  Q
    ||    
T  35856387 ct 35856388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University