View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10349_low_20 (Length: 259)

Name: NF10349_low_20
Description: NF10349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10349_low_20
NF10349_low_20
[»] chr3 (2 HSPs)
chr3 (20-201)||(47713143-47713324)
chr3 (215-250)||(47713356-47713391)


Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 47713143 - 47713324
Alignment:
Q  20 ttcgccgcatccctcaccgcaatctcttcactcatcaaagagtcttcatcggtataatcgtgaagtaccgaaaaggggttttggattttcttaaccggag 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||    
T  47713143 ttcgccgcatccctcaccgcaatctcttcactcatcaaagagtcttcatcagtataatcgtgaagtaccgaaaaggggttttggattttcttaaccagag 47713242  T
Q  120 ggggtttaacttgaaccaaagggggtttaaactcccattgttcttgatcgaattttctaacaccaaaacgggtttttgattt 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||    
T  47713243 ggggtttaacttgaaccaaagggggtttaaactcccattgttcttgatcgaattttcttacaccaaagcgggtttttgattt 47713324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 215 - 250
Target Start/End: Original strand, 47713356 - 47713391
Alignment:
Q  215 ctgtaggctgctaatttcttttgattccattcttct 250  Q
    ||||||||||||||||||||||||||||||||||||    
T  47713356 ctgtaggctgctaatttcttttgattccattcttct 47713391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University