View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10346_low_69 (Length: 211)

Name: NF10346_low_69
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10346_low_69
NF10346_low_69
[»] chr4 (2 HSPs)
chr4 (98-203)||(19118993-19119094)
chr4 (19-54)||(19118907-19118943)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 98 - 203
Target Start/End: Original strand, 19118993 - 19119094
Alignment:
Q  98 atttgcataacataagaatcaatattaactaataaataaatttcaaatatactcaaatgttttatcgatctactaaccaatttacattatctcttagctc 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||    
T  19118993 atttgcataacataagaatcaatattaactaataaataaatttcaaatatactcaaatgttttatcgatct----accaatttacattatctcttagctc 19119088  T
Q  198 tctgct 203  Q
    | ||||    
T  19119089 tttgct 19119094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 54
Target Start/End: Original strand, 19118907 - 19118943
Alignment:
Q  19 gtatcatgtcgatatgaatccc-aaaaaacaaaatct 54  Q
    |||||||||||||||||||||| ||||||||||||||    
T  19118907 gtatcatgtcgatatgaatcccaaaaaaacaaaatct 19118943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University