View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10346_high_13 (Length: 422)

Name: NF10346_high_13
Description: NF10346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10346_high_13
NF10346_high_13
[»] chr5 (3 HSPs)
chr5 (1-85)||(42219514-42219598)
chr5 (312-375)||(42219246-42219309)
chr5 (15-82)||(5404546-5404613)
[»] chr2 (1 HSPs)
chr2 (15-84)||(3085237-3085306)


Alignment Details
Target: chr5 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 42219598 - 42219514
Alignment:
Q  1 cgttgcttgagaggaaggcgaagggacgtgctgccgctgataaggagaagggtactaagtttggtgctgaagatattatgcagaa 85  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42219598 cgttgcttgagaggaaggcgaagggacgtgctgccgctgataaggagaagggtactaagtttggtgctgaagatattatgcagaa 42219514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 312 - 375
Target Start/End: Complemental strand, 42219309 - 42219246
Alignment:
Q  312 caatgttgtgaaaagaaaagaaatttagggttgagacctctctagggtcgatacttttgattga 375  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42219309 caatgttgtgaaaagaaaagaaatttagggttgagacctctctagggtcgatacttttgattga 42219246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 15 - 82
Target Start/End: Original strand, 5404546 - 5404613
Alignment:
Q  15 aaggcgaagggacgtgctgccgctgataaggagaagggtactaagtttggtgctgaagatattatgca 82  Q
    ||||||||||| |||||||| ||||||||||| |||||||| ||||||| | ||||||| ||||||||    
T  5404546 aaggcgaagggtcgtgctgctgctgataaggaaaagggtaccaagtttgctcctgaagacattatgca 5404613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 15 - 84
Target Start/End: Complemental strand, 3085306 - 3085237
Alignment:
Q  15 aaggcgaagggacgtgctgccgctgataaggagaagggtactaagtttggtgctgaagatattatgcaga 84  Q
    ||||| ||||| |||||||| |||||||||||||||||||||||||||| | |||| |||||||||||||    
T  3085306 aaggctaagggtcgtgctgctgctgataaggagaagggtactaagtttgctcctgaggatattatgcaga 3085237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University